Exosomal microRNA­4516, microRNA­203 and SFRP1 are potential biomarkers of acute myocardial infarction.

Acute myocardial infarction (AMI) is a serious disease which threatens public health. Exosomes (exos) contain certain genetic information and are important communication vehicles between cells. In the present study, different exosomal microRNAs (miRs), which exhibit a notable association between expression levels in plasma and AMI were assessed to support the development of new diagnostic and clinical assessment markers of patients with AMI. In total, 93 individuals, including 31 healthy controls and 62 patients with AMI, were recruited for the present study. Data on age, blood pressure, glucose levels, lipid levels and coronary angiography images were collected from the enrolled individuals, and plasma samples were collected. Plasma exos were extracted and verified using ultracentrifugation, transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA) and western blotting (WB). Exo­miR­4516 and exo­miR­203 in plasma exos were identified by exosomal miRNA sequencing analysis, reverse transcription­quantitative PCR was performed to detect the levels of exo­miR­4516 and exo­miR­203 in plasma exos, and ELISA was performed to detect the levels of secretory frizzled­related protein 1 (SFRP1) in samples. The correlation analysis between exo­miR­4516, exo­miR­203 and SFRP1 in plasma exos and AMI was presented as receiver operating characteristic curves (ROCs) of the SYNTAX score, cardiac troponin I (cTnI), low­density lipoprotein (LDL) and each indicator separately. Kyoto Encyclopedia of Genes and Genomes enrichment analysis was performed to predict relevant enrichment pathways. Exos were successfully isolated from plasma by ultracentrifugation, which was confirmed by TEM, NTA and WB. Exo­miR­4516, exo­miR­203 and SFRP1 levels in plasma were significantly higher in the AMI group compared with the healthy control group. ROCs demonstrated that exo­miR­4516, exo­miR­203 and SFRP1 levels had a high diagnostic efficiency in predicting AMI. Exo­miR­4516 was positively correlated with SYNTAX score, and plasma SFRP1 was positively correlated with plasma cTnI and LDL. In conclusion, the data demonstrated that exo­miR­4516, exo­miR­203 and SFRP1 levels could be used in combination to diagnose and assess the severity of AMI. The present study was retrospectively registered (TRN, NCT02123004).

DCE-MRI and DWI can differentiate benign from malignant prostate tumors when serum PSA is ≥10 ng/ml.

Background: This study investigated the diagnostic utility of dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) and diffusion-weighted imaging (DWI) parameters for distinguishing between benign and malignant prostate tumors when serum prostate-specific antigen (PSA) level is ≥10 ng/ml. Methods: Patients with prostate cancer (PCa) and benign prostatic hyperplasia (BPH) with serum PSA ≥10 ng/ml before treatment were recruited. Transrectal ultrasound-guided biopsy or surgery was performed for tumor classification and patients were stratified accordingly into PCa and BPH groups. Patients underwent DCE-MRI and DWI scanning and the transfer constant (Ktrans), rate constant (Kep), fractional volume of the extravascular extracellular space, plasma volume (Vp), and Prostate Imaging Reporting and Data System Version 2 (PI-RADS v2) score were determined. The apparent diffusion coefficient (ADC) was calculated from DWI. The diagnostic performance of these parameters was assessed by receiver operating characteristic (ROC) curve analysis, and those showing a significant difference between the PCa and BPH groups were combined into a multivariate logistic regression model for PCa diagnosis. Spearman's correlation was used to analyze the relationship between Gleason score and imaging parameters. Results: The study enrolled 65 patients including 32 with PCa and 33 with BPH. Ktrans (P=0.006), Kep (P=0.001), and Vp (P=0.009) from DCE-MRI and ADC (P<0.001) from DWI could distinguish between the 2 groups when PSA was ≥10 ng/ml. PI-RADS score (area under the ROC curve [AUC]=0.705), Ktrans (AUC=0.700), Kep (AUC=0.737), Vp (AUC=0.688), and ADC (AUC=0.999) showed high diagnostic performance for discriminating PCa from BPH. A combined model based on PI-RADS score, Ktrans, Kep, Vp, and ADC had a higher AUC (1.000), with a sensitivity of 0.998 and specificity of 0.999. Imaging markers showed no significant correlation with Gleason score in PCa. Conclusion: DCE-MRI and DWI parameters can distinguish between benign and malignant prostate tumors in patients with serum PSA ≥10 ng/ml.

Macrophage-derived exosomal miR-4532 promotes endothelial cells injury by targeting SP1 and NF-κB P65 signalling activation.

Atherosclerosis is a complex pathological process involving macrophages, endothelial cells and vascular smooth muscle cells that can lead to ischemic heart disease; however, the mechanisms underlying cell-to-cell communication in atherosclerosis are poorly understood. In this study, we focused on the role of exosomal miRNAs in crosstalk between macrophages and endothelial cells and explored the rarely studied molecular mechanisms involved. Our in vitro result showed that macrophage-derived exosomal miR-4532 significantly disrupted human umbilical vein endothelial cells (HUVECs) function by targeting SP1 and downstream NF-κB P65 activation. In turn, increased endothelin-1 (ET-1), intercellular cell adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) and decreased endothelial nitric oxide synthase (eNOS) expression in HUVECs increased attraction of macrophages, exacerbating foam cell formation and transfer of exosomal miR-4532 to HUVECs. MiR-4532 overexpression significantly promoted endothelial injury and pretreatment with an inhibitor of miR-4532 or GW4869 (exosome inhibitor) could reverse this injury. In conclusion, our data reveal that exosomes have a critical role in crosstalk between HUVECs and macrophages. Further, exosomal miR-4532 transferred from macrophages to HUVECs and targeting specificity protein 1 (SP1) may be a novel therapeutic target in patients with atherosclerosis.

Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases.

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.

Involvement of hypoxia-inducible factor-1 alpha in the upregulation of P-glycoprotein in refractory epilepsy.

To explore the involvement of hypoxia-inducible factor-1 alpha (HIF-1α) in the upregulation of P-glycoprotein (P-gp) in refractory epilepsy. Brain tissue specimens were collected and analyzed for expression of HIF-1α and P-gp using an immunohistochemical (IHC) staining method in both refractory epilepsy group and control group. Correlation between HIF-1α and P-gp expression level in refractory epilepsy group was analyzed. Then, a hypoxia cell model was established by simulating the nerve cell hypoxic microenvironment in the human U251 cell line using cobalt chloride (CoCl2). Western blot analysis was used to detect expression levels of HIF-1α and P-gp in the hypoxic cell model. Finally, expression of HIF-1α and P-gp was detected using real-time quantitative PCR and Western blot, respectively, after U251 hypoxic model cells were infected with HIF-1α siRNA. IHC scores of HIF-1α and P-gp in refractory epilepsy group were significantly higher than that in control group. In addition, the expression of HIF-1α was positively correlated with the expression of P-gp in refractory epilepsy group. Expression levels of HIF-1α and P-gp in U251 cells cultured with 250 µmol/L CoCl2 for 48 hours were significantly higher than that in controls. After transfection with siRNA targeting HIF-1α, expressions of HIF-1α and P-gp at mRNA and protein level were decreased, respectively, in the hypoxia cell model. HIF-1α may be involved in the upregulation of P-gp in refractory epilepsy through inducement of P-gp expression. Therefore, activation of the HIF-1α/P-gp pathway is one hypothesis proposed to explain the pathogenesis of refractory epilepsy.